Saltar al contenido
Merck

EHU070611

MISSION® esiRNA

targeting human RBBP8

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCCATGTCCGATACATAGAACAAACACATACTAAATTGGAGCACTCTGTGTGTGCAAATGAAATGAGAAAAGTTTCCAAGTCTTCAACTCATCCACAACATAATCCTAATGAAAATGAAATTCTAGTAGCTGACACTTATGACCAAAGTCAATCTCCAATGGCCAAAGCACATGGAACAAGCAGCTATACCCCTGATAAGTCATCTTTTAATTTAGCTACAGTTGTTGCTGAAACACTTGGACTTGGTGTTCAAGAAGAATCTGAAACTCAAGGTCCCATGAGCCCCCTTGGTGATGAGCTCTACCACTGTCTGGAAGGAAATCACAAGAAACAGCCTTTTGAGGAATCTACAAGAAATACTGAAGATAGTTTAAGATTTTCAGATTCTACTTCAAAGACTCCTCCTCAAGAAGAATTACCTACTCGAGTGTCATCTCCTGTATTTGGAGC

Ensembl | human accession no.

ENSG00000101773

NCBI accession no.

NM_203292

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
VDV
ACIU
WXU
WIU
BJT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Du et al.
Cancer research, 80(19), 4212-4223 (2020-08-21)
Elevated expression of EZH2, the enzymatic subunit of polycomb repressive complex 2 (PRC2), often occurs in cancer. EZH2 expression results in the silencing of genes that suppress tumor formation and metastasis through trimethylation of histone H3 at lysine 27 (H3K27me3)
Oriane Bombarde et al.
Molecular cancer therapeutics, 16(10), 2166-2177 (2017-06-15)
Poisons of topoisomerase II (TOP2) kill cancer cells by preventing religation of intermediate DNA breaks during the enzymatic process and thus by accumulating enzyme-drug-DNA complexes called TOP2 cleavage-complex (TOP2cc). F14512 is a highly cytotoxic polyamine-vectorized TOP2 inhibitor derived from etoposide
Ming Gao et al.
Nature communications, 11(1), 5362-5362 (2020-10-25)
Human C-terminal binding protein (CtBP)-interacting protein (CtIP) is a central regulator to initiate DNA end resection and homologous recombination (HR). Several studies have shown that post-translational modifications control the activity or expression of CtIP. However, it remains unclear whether and
Isabel Soria-Bretones et al.
Nature communications, 8(1), 113-113 (2017-07-26)
DNA breaks are complex DNA lesions that can be repaired by two alternative mechanisms: non-homologous end-joining and homologous recombination. The decision between them depends on the activation of the DNA resection machinery, which blocks non-homologous end-joining and stimulates recombination. On
Jianfeng Shen et al.
Cancer research, 79(2), 311-319 (2018-11-30)
PARP inhibitors (PARPi) have shown remarkable therapeutic efficacy against BRCA1/2-mutant cancers through a synthetic lethal interaction. PARPi exert their therapeutic effects mainly through the blockade of ssDNA damage repair, which leads to the accumulation of toxic DNA double-strand breaks specifically
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico