Saltar al contenido
Merck

EHU076421

MISSION® esiRNA

targeting human TCF4

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCATGGAGGTACAGACAAAGAAAGTTCGAAAAGTTCCTCCAGGTTTGCCATCTTCAGTCTATGCTCCATCAGCAAGCACTGCCGACTACAATAGGGACTCGCCAGGCTATCCTTCCTCCAAACCAGCAACCAGCACTTTCCCTAGCTCCTTCTTCATGCAAGATGGCCATCACAGCAGTGACCCTTGGAGCTCCTCCAGTGGGATGAATCAGCCTGGCTATGCAGGAATGTTGGGCAACTCTTCTCATATTCCACAGTCCAGCAGCTACTGTAGCCTGCATCCACATGAACGTTTGAGCTATCCATCACACTCCTCAGCAGACATCAATTCCAGTCTTCCTCCGATGTCCACTTTCCATCGTAGTGGTACAAACCATTACAGCACCTCTTCCTGTACGCCTCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TCF4(6925)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Stephen Gadomski et al.
Cell reports, 31(4), 107572-107572 (2020-04-30)
Investigating mechanisms that regulate endothelial cell (EC) growth and survival is important for understanding EC homeostasis and how ECs maintain stem cell niches. We report here that targeted loss of Id genes in adult ECs results in dilated, leaky sinusoids
Menglan Cheng et al.
Scientific reports, 5, 10752-10752 (2015-07-18)
Dendritic cells (DCs) are sentinels of the immune system and comprise two distinct subsets: conventional DCs (cDCs) and plasmacytoid DCs (pDCs). Human pDCs are distinguished from mouse pDCs phenotypically and functionally. Basic helix-loop-helix protein E2-2 is defined as an essential