Saltar al contenido
Merck

EHU078251

MISSION® esiRNA

targeting human CTH

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATTCGAAAGCCTTGCTGAGCTTCCGGCAATCATGACTCATGCATCAGTTCTTAAGAATGACAGAGATGTCCTTGGAATTAGTGACACACTGATTCGACTTTCTGTGGGCTTAGAGGATGAGGAAGACCTACTGGAAGATCTAGATCAAGCTTTGAAGGCAGCACACCCTCCAAGTGGAAGTCACAGCTAGTATTCCAGAGCTGCTATTAGAAGCTGCTTCCTGTGAAGATCAAATCTTCCTGAGTAATTAAATGGACCAACAATGAGCCTTTGCAAAATTTTCAAGCGGAAATTTTAAGGCACCTCATTATCTTTCATAACTGTAATTTTCTTAGGGATCATCTCTGTTAAAAAGTTTTCTGTATGTCATGTTATAATTACAGGTCAATTCTGTTAATATCTTTTTGTTAATTTTGCTCTATGTTTGCCTCTGAAGGAGGT

Ensembl | human accession no.

ENSG00000116761

NCBI accession no.

NM_001902

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... CTH(1491)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
SNS
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qian-Rong Qi et al.
Endocrinology, 161(11) (2020-09-29)
Angiogenesis is a physiological process for endometrial regeneration in the menstrual cycle and remodeling during pregnancy. Endogenous hydrogen sulfide (H2S), produced by cystathionine-β synthase (CBS) and cystathionine-γ lyase (CSE), is a potent proangiogenic factor; yet, whether the H2S system is
Daoliang Xu et al.
Pharmacological research, 117, 357-369 (2017-01-15)
It has been suggested that excessive apoptosis in intervertebral disc cells induced by inflammatory cytokines, such as interleukin (IL)-1β, is related to the process of intervertebral disc degeneration (IVDD). Hydrogen sulfide (H
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has
Neil Dufton et al.
Scientific reports, 2, 499-499 (2012-07-13)
Hydrogen sulfide is an essential gasotransmitter associated with numerous pathologies. We assert that hydrogen sulfide plays an important role in regulating macrophage function in response to subsequent inflammatory stimuli, promoting clearance of leukocyte infiltrate and reducing TNF-α levels in vivo
Zhongjian Cheng et al.
Circulation, 134(19), 1467-1483 (2016-09-24)
Bone marrow cell (BMC)-based treatment for critical limb ischemia in diabetic patients yielded a modest therapeutic effect resulting from cell dysfunction. Therefore, approaches that improve diabetic stem/progenitor cell functions may provide therapeutic benefits. Here, we tested the hypothesis that restoration
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico