EHU084551
MISSION® esiRNA
targeting human STMN1
Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TACACTGCCTGTCGCTTGTCTTCTATTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... STMN1(3925)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Pinjie Bao et al.
Annals of surgical oncology, 24(13), 4017-4024 (2017-09-22)
Known as a microtubule-destabilizing protein, STMN1 (gene symbol: STMN1) regulates the dynamics of microtubules, cell cycle progress, and chemo-resistance against taxane agents. It is highly expressed in various human cancers and involved in cancer progression as well as poor prognosis.
C M Fife et al.
Oncogene, 36(4), 501-511 (2016-06-21)
Neuroblastoma, the most common solid tumor of young children, frequently presents with aggressive metastatic disease and for these children the 5-year survival rates are dismal. Metastasis, the movement of cancer cells from one site to another, involves remodeling of the
Valerie B Sampson et al.
Oncotarget, 7(52), 86594-86607 (2016-11-20)
Osteosarcoma is the most frequently occurring bone cancer in children and adolescents. Unfortunately, treatment failures are common. Eribulin is a synthetic microtubule inhibitor that has demonstrated activity in preclinical osteosarcoma models. The effects of eribulin were evaluated in two human