Saltar al contenido
Merck

EHU084631

MISSION® esiRNA

targeting human YTHDF1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGCGATAGCAACTCTCCTGGAAACGTCCAGCCTAATTCTGCCCCCAGCGTCGAATCCCACCCCGTCCTTGAAAAACTGAAGGCTGCTCACAGCTACAACCCGAAAGAGTTTGAGTGGAATCTGAAAAGCGGGCGTGTGTTCATCATCAAGAGCTACTCTGAGGACGACATCCACCGCTCCATTAAGTACTCCATCTGGTGTAGCACAGAGCACGGCAACAAGCGCCTGGACAGCGCCTTCCGCTGCATGAGCAGCAAGGGGCCCGTCTACCTGCTCTTCAGCGTCAATGGGAGTGGGCATTTTTGTGGGGTGGCCGAGATGAAGTCCCCCGTGGACTACGGCACCAGTGCCGGGGTCTGGTCTCAGGACAAGTGGAAGGGGAAGTTTGATGTCCAGTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiang Li et al.
Frontiers in oncology, 10, 234-234 (2020-03-21)
Ammonium tetrathiomolybdate (ATTM) has been used in breast cancer therapy for copper chelation, as elevated copper promotes tumor growth. ATTM is also an identified H2S donor and endogenous H2S facilitates VitB12-induced S-adenosylmethionine (SAM) generation, which have been confirmed in m6A
Ye Fu et al.
Nature chemical biology, 16(9), 955-963 (2020-05-27)
Diverse RNAs and RNA-binding proteins form phase-separated, membraneless granules in cells under stress conditions. However, the role of the prevalent mRNA methylation, m6A, and its binding proteins in stress granule (SG) assembly remain unclear. Here, we show that m6A-modified mRNAs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico