Saltar al contenido
Merck

EHU085231

MISSION® esiRNA

targeting human PLEKHA7

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human PLEKHA7

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACCTTAGGTCCCTTTGGAAACATTCCATTTGACTTTTCCCTGTTGTTTGAAATCCCATGTTTCCCTAAACCTCTAGCCTGATTGTTCTTTCCCTAATTCATTGCACAAGCTCCTTTGCTTTTAGTGTTACCGCTCATTGCCTCTCTAATCCTGCCTGATTGTGTTTACAGAAGCTTCTGATTTGCATTGAACATGCTCTAACTGGCCTGTGCTACTTATTACCGGGCTTGTAATAGCGGTTCTTGTCTCCATAGCCTGTTGAGTGTTCCCAGATGTGACTCACCTTTCTGCTGCCCTCTTCATGCAGGCCTACTGACTCATAATTCACTTGTCCCAAAAGCCACCCCACAAGCCTGAGCCAACCTGCTGCCTGACGCCACAGTCATTGGCAGAGGTCTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Antonis Kourtidis et al.
Nature cell biology, 17(9), 1145-1157 (2015-08-25)
E-cadherin and p120 catenin (p120) are essential for epithelial homeostasis, but can also exert pro-tumorigenic activities. Here, we resolve this apparent paradox by identifying two spatially and functionally distinct junctional complexes in non-transformed polarized epithelial cells: one growth suppressing at

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico