Saltar al contenido
Merck

EHU104601

MISSION® esiRNA

targeting human CHORDC1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCCAGATGAACCAATGACAAATTTGGAATTAAAAATATCTGCCTCCCTAAAACAAGCACTTGATAAACTTAAACTGTCATCAGGGAATGAAGAAAATAAGAAAGAAGAAGACAATGATGAAATTAAGATTGGGACCTCATGTAAGAATGGAGGGTGTTCAAAGACATACCAGGGTCTAGAGAGTCTAGAAGAAGTCTGTGTATATCATTCTGGAGTACCTATTTTCCATGAGGGGATGAAATACTGGAGCTGTTGTAGAAGAAAAACTTCTGATTTTAATACATTCTTAGCCCAAGAGGGCTGTACAAAAGGGAAACACATGTGGACTAAAAAAGATGCTGGGAAAAAAGTTGTTCCATGTAGACATGACTGGCATCAGACTGGAGGTGAAGTTACCATTTCAGTATATGCTAAAAACTCACTTCCAGAACTTAGCCGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHORDC1(26973)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Federica Fusella et al.
Nature communications, 8(1), 1636-1636 (2017-11-22)
NF-κB is a transcription factor involved in the regulation of multiple physiological and pathological cellular processes, including inflammation, cell survival, proliferation, and cancer cell metastasis. NF-κB is frequently hyperactivated in several cancers, including triple-negative breast cancer. Here we show that
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is
Federica Fusella et al.
The Journal of pathology, 234(2), 152-163 (2014-03-13)
Morgana/CHP-1 is a ubiquitously expressed protein able to inhibit ROCK II kinase activity. We have previously demonstrated that morgana haploinsufficiency leads to multiple centrosomes, genomic instability, and higher susceptibility to tumour development. While a large fraction of human cancers has