Saltar al contenido
Merck

EHU106441

MISSION® esiRNA

targeting human PTEN

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTEN(5728)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Hu Gao et al.
Reproduction (Cambridge, England) (2019-11-23)
Sertoli cells are indispensable for normal spermatogenesis and increasing evidence has shown that microRNAs (miRNAs) participate in the regulation of Sertoli cell growth. However, the functions and regulatory mechanisms of miRNAs in Sertoli cells of domestic animals have not been
Aram Ghalali et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110112-110112 (2020-04-16)
Akt kinase regulates several cellular processes, among them growth, proliferation and survival, and has been correlated to neoplastic disease. We report here crosstalk between several Akt regulatory phosphatases that controls the level of the activated form (phosphorylated) of Akt and
Huachao Shen et al.
Neuropathology : official journal of the Japanese Society of Neuropathology, 40(3), 224-231 (2020-02-11)
Neural stem cell (NSC) transplantation has emerged as a promising approach for the treatment of neurological disorders such as cerebral ischemia. As the majority of newly generated cells from exogenous NSCs fail to integrate into the ischemic brain and establish
Ye Wang et al.
OncoTargets and therapy, 13, 1909-1919 (2020-03-19)
Berberine (BBR), a traditional Chinese medicine, has been shown effects on inhibiting cancer development. Autophagy-mediated resistance plays an important role in cancer progression; therefore, regulation of autophagy is a novel therapeutic strategy for cancer treatment. However, effects of BBR on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico