Saltar al contenido
Merck

EHU107721

MISSION® esiRNA

targeting human HSF1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTCCCTCCTTGCTCGAGATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCCTGACCAAGCTGTGGACCCTCGTGAGCGACCCGGACACCGACGCGCTCATCTGCTGGAGCCCGAGCGGGAACAGCTTCCACGTGTTCGACCAGGGCCAGTTTGCCAAGGAGGTGCTGCCCAAGTACTTCAAGCACAACAACATGGCCAGCTTCGTGCGGCAGCTCAACATGTATGGCTTCCGGAAAGTGGTCCACATCGAGCAGGGCGGCCTGGTCAAGCCAGAGAGAGACGACACGGAGTTCCAGCACCCATGCTTCCTGCGTGGCCAGGAGCAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGTGTGTCCACCCTGAAGAGTGAAGACATAAAGATCCGCCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Antonio Cigliano et al.
Oncotarget, 8(33), 54149-54159 (2017-09-15)
Upregulation of the heat shock transcription factor 1 (HSF1) has been described as a frequent event in many cancer types, but its oncogenic role in hepatocellular carcinoma (HCC) remains poorly delineated. In the present study, we assessed the function(s) of
Ye-Ji Jeong et al.
PloS one, 10(6), e0128552-e0128552 (2015-06-02)
Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA
Ying Wang et al.
Redox biology, 37, 101699-101699 (2020-09-10)
Low density lipoprotein receptor-related protein 6 (LRP6), a Wnt co-receptor, induces multiple functions in various organs. We recently reported cardiac specific LRP6 deficiency caused cardiac dysfunction in mice. Whether cardiomyocyte-expressed LRP6 protects hearts against ischemic stress is largely unknown. Here
Liqun Shang et al.
Life sciences, 241, 117120-117120 (2019-12-12)
The present study explored the function and regulatory mechanism of High mobility group box 1 (HMGB1) in asthma. OVA (ovalbumin)-induced asthmatic mice model and LPS-treated cellular model were established in this study. Airway inflammation was measured through detecting the expression
Seok Jun Kim et al.
Yonsei medical journal, 59(9), 1041-1048 (2018-10-18)
Heat shock factor 1 (HSF1) is a key regulator of the heat shock response and plays an important role in various cancers. However, the role of HSF1 in gastric cancer is still unknown. The present study evaluated the function of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico