Saltar al contenido
Merck

EHU108071

MISSION® esiRNA

targeting human SCD

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human SCD

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCATTGCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCACCACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTAGACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCTGGCTTGCTGATGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAAACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCCACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATTAGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTACC

Ensembl | human accession no.

ENSG00000099194

NCBI accession no.

NM_005063

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... SCD(6319), SCD(6319)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mohamed Amine Lounis et al.
Cancers, 12(11) (2020-11-15)
De novo lipogenesis (DNL) is now considered as a hallmark of cancer. The overexpression of key enzymes of DNL is characteristic of both primary and advanced disease and may play an important role in resistance to therapies. Here, we showed
Lei Li et al.
PloS one, 8(9), e75104-e75104 (2013-09-27)
Increased de novo lipogenesis is one of the major metabolic events in cancer. In human hepatocellular carcinoma (HCC), de novo lipogenesis has been found to be increased and associated with the activation of AKT/mTOR signaling. In mice, overexpression of an
Youping Zhou et al.
Aging, 12(8), 7350-7362 (2020-04-24)
SCD1 is a key enzyme controlling lipid metabolism and a link between its activity and NAFLD has been proposed. Lipophagy is a novel regulatory approach to lipid metabolism regulation, which is involved in the development of NAFLD. However, the possible
Dawei Yao et al.
Journal of cellular physiology, 232(3), 635-649 (2016-06-25)
Stearoyl-CoA desaturase 1 (SCD1) is a key enzyme for the synthesis of the monounsaturated fatty acids (MUFA) palmitoleic acid and oleic acid. In non-ruminant species, SCD1 expression is known to be tightly regulated by a variety of transcription factors. Although
Yurena Vivas-García et al.
Molecular cell, 77(1), 120-137 (2019-11-18)
Phenotypic and metabolic heterogeneity within tumors is a major barrier to effective cancer therapy. How metabolism is implicated in specific phenotypes and whether lineage-restricted mechanisms control key metabolic vulnerabilities remain poorly understood. In melanoma, downregulation of the lineage addiction oncogene
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico