Saltar al contenido
Merck

EHU133271

MISSION® esiRNA

targeting human NCOA4

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human NCOA4

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCAGCCTTTCTGCTGATTATCACACATCATGAGCTGAGTGACTGCAGCTTGCCAAATCTTTGTGTTTCTGGGTCTGACCAATTAGCTTAGTTCTTCTCCTGCCTAATTTTGAACTAGTAAAGCAAAGTGAGTCATCAGATTATGAGTTACTGTTTAAAAGAAAAATGCTGTTTATTCATGCTGAGGTGATTCAGTTCCCTCCTTCTTACAGAAGTATTTTAATTCACCCCACACTAGAAATGCAGCATCTTTGTGGACGTCTTTTTCACAAGCCTCCAAGGCTCCTTAGATTGGGTCGTTACTAAAAGTACATTAAAACACTCTTGTTTATCGAAGTATATTGATGTATTCTAAAGCTAGTAAACTTCCCTAACGTTTAATTGCCCTACAGATGCTTCTCTTGCTGTGGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Motoki Fujimaki et al.
Molecular and cellular biology, 39(14) (2019-05-08)
Iron is an essential nutrient for mitochondrial metabolic processes, including mitochondrial respiration. Ferritin complexes store excess iron and protect cells from iron toxicity. Therefore, iron stored in the ferritin complex might be utilized under iron-depleted conditions. In this study, we
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico