Saltar al contenido
Merck

EHU138421

MISSION® esiRNA

targeting human DHODH

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGAAAGAGCAGGGCTTTGGCGGAGTCACAGATGCCATTGGAGCAGATCATCGGAGGTGAGGACAGCGTCTGACGGGAAGCCTGATCTGGAACCTTCCCAAGGACTCAGGCAAGCCTTTGTGGCTGGATCATGAGAGGAGGGACTCCATCTTGAGCCATGTCCCCCAGCCATGGCATGGCTGCACTGTAAACGCCAATCGGGGGGTCACCAGGATCAACCGCAGGCTTTCTTCAGTCCCTTGGTCAGACCATAAACTGCATTTTTGATTCTTTGTGGATTCAAACCCTAGGATCCATCAGTCTTGCAAGGACATTGAATATTAGGAGGAAAAAGTCATGGAAAAAATAAAGCCATTTAGAACCTGGGTTTCAACGCTAGCCCTTTCTGGTTTGCCATAGGCCCTGCCAAGATACTGCAGGTCCATCCAGG

Ensembl | human accession no.

ENSG00000102967

NCBI accession no.

NM_001361

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xuemei Qiu et al.
International journal of oral science, 13(1), 3-3 (2021-01-30)
Oral squamous cell carcinoma (OSCC) become a heavy burden of public health, with approximately 300 000 newly diagnosed cases and 145 000 deaths worldwide per year. Nucleotide metabolism fuel DNA replication and RNA synthesis, which is indispensable for cell proliferation.
Deepti Mathur et al.
Cancer discovery, 7(4), 380-390 (2017-03-04)
Metabolic changes induced by oncogenic drivers of cancer contribute to tumor growth and are attractive targets for cancer treatment. Here, we found that increased growth of PTEN-mutant cells was dependent on glutamine flux through the de novo pyrimidine synthesis pathway
Mathura Subangari Dorasamy et al.
Journal of Cancer, 8(15), 3086-3098 (2017-09-21)
Dihydroorotate dehydrogenase (DHODH) is a rate-limiting enzyme in the
T He et al.
Oncogene, 33(27), 3538-3549 (2013-09-10)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising agent in selectively killing tumor cells. However, TRAIL monotherapy has not been successful as many cancer cells are resistant to TRAIL. Chemotherapeutic agents, such as doxorubicin have been shown to act

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico