EHU157961
MISSION® esiRNA
targeting human CD74
Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACACAGGCTTTTCCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGCGCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGCTGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGTATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAATGCTGACCCCCTGAAGGTGTACCCGCCACTGAAGGGGAGCTTCCCGGAGAACCTGAGACACCTTAAGAACACCATGGAGACCATAGACTGGAAGGTCTTTGAGAGCTGGATGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CD74(972)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Pei-Chi Chan et al.
Clinical science (London, England : 1979), 132(14), 1581-1596 (2018-05-19)
Adipose tissue (AT) inflammation is crucial to the development of obesity-associated insulin resistance. Our aim was to investigate the contribution of cyclooxygenase-2 (COX-2)/macrophage migration inhibitory factor (MIF)-mediated cross-talk between hypertrophic adipocytes and macrophages to the etiology of AT inflammation and
Jing-Nan Liang et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2441-2450 (2019-06-09)
Although macrophage migration inhibitory factor (MIF) is known to have antioxidant property, the role of MIF in cardiac fibrosis has not been well understood. We found that MIF was markedly increased in angiotension II (Ang-II)-infused mouse myocardium. Myocardial function was
Jun-Wei Gai et al.
Oncology letters, 15(5), 7631-7638 (2018-05-08)
The aim of the present study was to investigate the expression and potential roles of CD74 in human urothelial cell carcinoma of the bladder (UCB) in vitro and in vivo. CD74 and macrophage migration inhibitory factor (MIF) were located and