Saltar al contenido
Merck

EHU159481

MISSION® esiRNA

targeting human NCOR2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACGAGGTGTCAGAGATCATCGATGGCCTCTCAGAGCAGGAGAACCTGGAGAAGCAGATGCGCCAGCTGGCCGTGATCCCGCCCATGCTGTACGACGCTGACCAGCAGCGCATCAAGTTCATCAACATGAACGGGCTTATGGCCGACCCCATGAAGGTGTACAAAGACCGCCAGGTCATGAACATGTGGAGTGAGCAGGAGAAGGAGACCTTCCGGGAGAAGTTCATGCAGCATCCCAAGAACTTTGGCCTGATCGCATCATTCCTGGAGAGGAAGACAGTGGCTGAGTGCGTCCTCTATTACTACCTGACTAAGAAGAATGAGAACTATAAGAGCCTGGTGAGACGGAGCTATCGGCGCCGCGGCAAGAGCCAGCAGCAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCCATGCCCCGCAGCAGCCAGGAGGAGAAAGATGAGAAGGAGAAGGAAAAGGAGGCGGAGAAGGAGGAGGAGAAGCCGGAGGTGGAGAACGACAAGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NCOR2(9612)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ligand Activation of PPARγ by Ligustrazine Suppresses Pericyte Functions of Hepatic Stellate Cells via SMRT-Mediated Transrepression of HIF-1α.
Feng Zhang et al.
Theranostics, 8(3), 610-626 (2018-01-19)
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Jil Sander et al.
Immunity, 47(6), 1051-1066 (2017-12-21)
Human in vitro generated monocyte-derived dendritic cells (moDCs) and macrophages are used clinically, e.g., to induce immunity against cancer. However, their physiological counterparts, ontogeny, transcriptional regulation, and heterogeneity remains largely unknown, hampering their clinical use. High-dimensional techniques were used to elucidate transcriptional, phenotypic
Nikhil Sharma et al.
Neuron, 102(2), 390-406 (2019-03-09)
Neuronal activity-dependent transcription is tuned to ensure precise gene induction during periods of heightened synaptic activity, allowing for appropriate responses of activated neurons within neural circuits. The consequences of aberrant induction of activity-dependent genes on neuronal physiology are not yet

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico