Saltar al contenido
Merck

EHU228771

MISSION® esiRNA

targeting human USP17L2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGATTTCAGACACTTTTGACCCTTACCTGGACATCGCCCTGGATATCCAGGCAGCTCAGAGTGTCAAGCAAGCTTTGGAACAGTTGGTGAAGCCCGAAGAACTCAATGGAGAGAATGCCTATCATTGCGGTCTTTGTCTCCAGAGGGCGCCGGCCTCCAAGACGTTAACTTTACACACTTCTGCCAAGGTCCTCATCCTTGTCTTGAAGAGATTCTCCGATGTCACAGGCAACAAACTTGCCAAGAATGTGCAATATCCTGAGTGCCTTGACATGCAGCCATACATGTCTCAGCAGAACACAGGACCTCTTGTCTATGTCCTCTATGCTGTGCTGGTCCACGCTGGGTGGAGTTGTCACGACGGACATTACTTCTCTTATGTCAAAGCTCAAGAAGGCCAGTGGTATAAAATGGATGATGCCAAGGTCACTGCCTGTAGCATCACTTCTGTCCTGAGTCAACAGGCCTATGTCCTCTTTTACATCCAGAAGAGTGAATGGGAAAGACACAGTGA

Ensembl | human accession no.

ENSG00000223443

NCBI accession no.

NM_201402

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

wgk

WGK 1

Clase de almacenamiento

12 - Non Combustible Liquids

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gabor Borbely et al.
Oncotarget, 6(32), 33623-33635 (2015-09-18)
Members of the bromodomain and extra-C terminal (BET) domain protein family and the histone deacetylase (HDAC) enzyme family regulate the expression of important oncogenes and tumor suppressor genes. Here we show that the BET inhibitor JQ1 inhibits proliferation and induces
Michelle de la Vega et al.
Nature communications, 2, 259-259 (2011-03-31)
Deubiquitinating enzymes are now emerging as potential therapeutic targets that control many cellular processes, but few have been demonstrated to control cell motility. Here, we show that ubiquitin-specific protease 17 (USP17) is rapidly and transiently induced in response to chemokines
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks
M Mehić et al.
Oncogenesis, 6(6), e348-e348 (2017-06-13)
The levels of hyaluronan, a ubiquitous glycosaminoglycan prominent in the extracellular matrix, is balanced through the actions of hyaluronan-synthesizing enzymes (HAS1, 2 and 3) and degrading hyaluronidases (Hyal 1, 2, 3 and PH20). Hyaluronan accumulates in rapidly remodeling tissues, such

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico