Saltar al contenido
Merck

EMU007401

MISSION® esiRNA

targeting mouse Atg4b

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGCAGCCACTTTGACATATGATACTCTCCGGTTTGCTGAATTTGAAGATTTCCCTGAGACCTCAGAGCCTGTTTGGATTCTGGGCAGAAAATACAGCATTTTCACAGAGAAGGACGAAATCTTGTCTGATGTTGCATCCAGACTTTGGTTTACATACAGGAGAAACTTTCCAGCTATTGGGGGAACTGGCCCTACTTCAGACACAGGCTGGGGTTGCATGCTTCGGTGTGGACAGATGATCTTTGCCCAGGCCCTGGTATGCCGGCACTTAGGTCGAGATTGGAGGTGGACTCAGCGGAAGAGGCAGCCTGACAGCTACTTTAATGTCCTCAATGCTTTCCTCGACAGGAAGGACAGCTACTATTCCATCCATCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCTA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Katharina Rothe et al.
Blood, 123(23), 3622-3634 (2014-04-24)
Previous studies demonstrated that imatinib mesylate (IM) induces autophagy in chronic myeloid leukemia (CML) and that this process is critical to cell survival upon therapy. However, it is not known if the autophagic process differs at basal levels between CML
Pei-Feng Liu et al.
Autophagy, 10(8), 1454-1465 (2014-07-06)
Autophagy is reported to suppress tumor proliferation, whereas deficiency of autophagy is associated with tumorigenesis. ATG4B is a deubiquitin-like protease that plays dual roles in the core machinery of autophagy; however, little is known about the role of ATG4B on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico