EMU010891
MISSION® esiRNA
targeting mouse Tcf7l2
Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCACGCCTCTCATCACGTACAGCAATGAACACTTCACCCCGGGAAATCCACCTCCGCACTTACCAGCTGACGTAGACCCCAAAACAGGAATCCCAAGGCCTCCGCACCCTCCAGATATCTCTCCATATTACCCGCTGTCGCCCGGCACCGTAGGACAAATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCTGTGTACCCAATCACGACAGGAGGATTCAGACACCCCTACCCCACAGCGCTGACAGTCAACGCATCTATGTCTAGGTTCCCTCCCCATATGGTCCCTCCCCATCACACTCTGCACACGACCGGCATCCCTCACCCGGCCATCGTCACACCGACAGTCAAGCAGGAATCCTCCCAGAGTGACGTCGGCTCACTCCACAGCTCAAAGCATCAGGACTCC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TCF7L2(21416), Tcf7l2(21416)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Chong Chen et al.
Cancer research, 75(8), 1725-1735 (2015-03-07)
Considerable evidence suggests that proinflammatory pathways drive self-renewal of cancer stem-like cells (CSC), but the underlying mechanisms remain mainly undefined. Here we report that the let7 repressor LIN28B and its regulator IKBKB (IKKβ) sustain cancer cell stemness by interacting with