Saltar al contenido
Merck

EMU014431

MISSION® esiRNA

targeting mouse Bsg

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting mouse Bsg

Gene Information

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCTGCATCTTCCTTCCTGAGCCTGTGGGCAGAAGCGAGATCAATGTGGAAGGGCCACCCAGGATCAAGGTCGGAAAGAAATCAGAGCATTCCAGTGAGGGAGAGCTTGCGAAACTGGTCTGCAAGTCCGATGCATCCTACCCTCCTATTACAGATTGGTTCTGGTTTAAGACCTCTGACACTGGGGAAGAAGAGGCAATCACCAATAGCACTGAAGCCAATGGCAAGTATGTGGTGGTATCCACGCCTGAGAAGTCACAGCTGACCATCAGCAACCTTGACGTAAATGTTGACCCTGGCACCTACGTGTGTAATGCCACCAACGCCCAGGGCACTACTCGGGAAACCATCTCACTGCGTGTGCGGAGCCGCATGGCAGCCCTCTGGCCCTTCCTAGGCATCGTGGCTGAGGTCCTGGTGTTGGTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lipan Peng et al.
Molecular and cellular biochemistry, 405(1-2), 73-79 (2015-04-12)
Chemotherapy remains the core of anticancer treatment. However, despite the tremendous strides made in the development of targeted anticancer therapies, emergence of resistance to chemotherapeutic drugs is still a major obstacle in the successful management of resistant tumors. Therefore, profound
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Eleni Milia-Argeiti et al.
Biochimica et biophysica acta, 1840(8), 2581-2588 (2014-03-13)
Elevated levels of EMMPRIN/CD147 in cancer tissues have been correlated with tumor progression but the regulation of its expression is not yet understood. Here, the regulation of EMMPRIN expression was investigated in testicular germ cell tumor (TGCTs) cell lines. EMMPRIN

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico