Saltar al contenido
Merck

EMU015011

MISSION® esiRNA

targeting mouse Akt1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACGATGGCACCTTTATTGGCTACAAGGAACGGCCTCAGGATGTGGATCAGCGAGAGTCCCCACTCAACAACTTCTCAGTGGCACAATGCCAGCTGATGAAGACAGAGCGGCCAAGGCCCAACACCTTTATCATCCGCTGCCTGCAGTGGACCACAGTCATTGAGCGCACCTTCCATGTGGAAACGCCTGAGGAGCGGGAAGAATGGGCCACCGCCATTCAGACTGTGGCCGATGGACTCAAGAGGCAGGAAGAAGAGACGATGGACTTCCGATCAGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGTGTGACCATGAACGAGTTTGAGTACCTGAAACTACTGGGCAAGGGCACCTTTGGGAAAGTGATTCTGGTGAAAGAGAAGGCCACAGG

Ensembl | mouse accession no.

ENSMUSG00000001729

NCBI accession no.

NP_033782

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... AKT1(11651), Akt1(11651)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
PQS
IBS
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lucía Barbier-Torres et al.
Oncotarget, 6(4), 2509-2523 (2015-02-05)
The current view of cancer progression highlights that cancer cells must undergo through a post-translational regulation and metabolic reprogramming to progress in an unfriendly environment. In here, the importance of neddylation modification in liver cancer was investigated. We found that
Tsung-Chieh Lin et al.
The Journal of pathology, 237(1), 50-61 (2015-05-01)
Ghrelin is an appetite-regulating molecule that promotes growth hormone (GH) release and food intake through growth hormone secretagogue receptor (GHS-R). Recently, high ghrelin levels have been detected in various types of human cancer. Ghrelin expression is observed in proximal and
Heming Li et al.
Molecular cancer, 13, 136-136 (2014-06-03)
Insulin-like growth factor I (IGF-I) can induce epithelial mesenchymal transition (EMT) in many epithelial tumors; however, the molecular mechanism by which this occurs is not clearly understood. Additionally, little is known about the involvement of IGF-I in gastric cancer. Two
Xiaozhan Zhang et al.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 34, 415-422 (2015-06-13)
Viral infections activate many host signaling pathways, including the phosphatidylinositol 3-kinase (PI3K)/Akt pathway, which has recently attracted considerable interest due to its central role in modulating virus replication. This study demonstrated that the sero-type 3 reovirus strain Masked Palm Civet/China/2004
Bernadette Chen et al.
American journal of physiology. Lung cellular and molecular physiology, 307(4), L317-L325 (2014-06-22)
Pulmonary artery smooth muscle cell (PASMC) proliferation plays a fundamental role in the vascular remodeling seen in pulmonary hypertensive diseases associated with hypoxia. Arginase II, an enzyme regulating the first step in polyamine and proline synthesis, has been shown to
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico