Saltar al contenido
Merck

EMU057231

MISSION® esiRNA

targeting mouse Hc

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGTTTCTGAATCCTGCTACCTTCACGGTGTACGAGTATCACAGACCAGATAAGCAGTGCACCATGATTTATAGCATTTCTGACACCAGGCTTCAGAAAGTCTGTGAAGGAGCAGCTTGCACATGTGTGGAAGCTGACTGTGCGCAACTGCAGGCAGAAGTAGACCTAGCCATCTCTGCAGACTCCAGAAAAGAGAAAGCCTGTAAACCAGAGACTGCATATGCTTATAAAGTCAGGATCACATCAGCCACTGAAGAAAATGTTTTTGTCAAGTACACTGCGACTCTTCTGGTCACTTACAAAACAGGGGAAGCTGCTGATGAGAATTCGGAGGTCACCTTCATTAAAAAGATGAGCTGTACCAATGCCAACCTGGTGAAAGGGAAGCAGTATTTAATCATGGGCAAAGAGGTTCTGCAGATCAAACACAATTTCAGTTTCAAGTATATATACCCTCTAGATTCCTCCACCTGGATTGAATATTGGCCCACAGACACAACGTGTCCATCCTGTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... HC(15139), Hc(15139)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Gaurav Mehta et al.
Journal of immunology (Baltimore, Md. : 1950), 194(11), 5446-5454 (2015-04-29)
Rheumatoid arthritis (RA) is an inflammatory autoimmune joint disease in which the complement system plays an important role. Of the several components of complement, current evidence points to C5 as the most important inducer of inflammation. Several groups generated Abs
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Xiaofei Yan et al.
Molecular and cellular biochemistry, 398(1-2), 95-104 (2014-09-14)
Excessive reactive oxygen species (ROS) generation has been implicated as one of main agents in ouabain-induced anticancer effect. Unfortunately, the signaling pathways under it are not very clarified. In the present study, we investigated the molecular mechanism involved in ouabain-induced