Saltar al contenido
Merck

EMU064061

MISSION® esiRNA

targeting mouse Mcl1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting mouse Mcl1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTTTGTGGAGTTCTTCCACGTACAGGACCTAGAAGGCGGCATCAGAAATGTGCTGCTGGCTTTTGCGGGTGTTGCTGGAGTAGGGGCTGGTCTGGCATATCTAATAAGATAGCCTTGTGAGTGCAATAGGGGACTCTTAAAGCTCCAGCCACCAAACTACATGCATCTGTGAAAACATGTGTATTTATGAAGGTGGACTTGAAGCTGCCCAGGATTTTAACAGTCCAGTTCTACTGTAGCAACATAGCAAAAAGAAAGTGGCTACAGGATTGTGGCTAACAAGAATAAATACATGGGAAAAGTGCTCCCCCTGGAAGAGTCACTGTCTGAATGAAGCAAAGTTCCCTCTCAGCAAACACTGAGAGGCCATGGAGAAGGACTTCTAGAATGAATGAAAGGGGTGGA

Ensembl | mouse accession no.

ENSMUSG00000038612

NCBI accession no.

NM_008562

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... MCL1(17210), Mcl1(17210)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
Tadashi Inoue et al.
Human molecular genetics, 23(21), 5672-5682 (2014-06-09)
Latent TGF-β-binding protein-2 (LTBP-2) is an extracellular matrix protein associated with microfibrils. Homozygous mutations in LTBP2 have been found in humans with genetic eye diseases such as congenital glaucoma and microspherophakia, indicating a critical role of the protein in eye
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
Chun-Te Wu et al.
BMC cancer, 14, 375-375 (2014-06-03)
The identification of potential tumor markers will help improve therapeutic planning and patient management. Thrombomodulin (TM) is a sensitive urothelial marker. TM was reported to be one of the endogenous anti-metastatic factors and has diagnostic and prognostic values for the
Elisabeth Losdyck et al.
The Journal of biological chemistry, 290(48), 29022-29034 (2015-10-09)
JAK1 and JAK3 are recurrently mutated in acute lymphoblastic leukemia. These tyrosine kinases associate with heterodimeric cytokine receptors such as IL-7 receptor or IL-9 receptor, in which JAK1 is appended to the specific chain, and JAK3 is appended to the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico