Saltar al contenido
Merck

EMU074451

MISSION® esiRNA

targeting mouse Mapk8

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATCATGAGCAGAAGCAAACGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTAAAACGATACCAGAATTTAAAGCCTATAGGCTCAGGAGCTCAAGGAATAGTGTGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTCAGCCGGCCATTTCAGAATCAGACCCATGCTAAGCGCGCCTACCGAGAACTAGTTCTTATGAAGTGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGTTAGATCATGAAAGAATGTCCTACCTTCTCTATCAAATGCTGTGTGGAATCAAGCACCTTCACTCTGCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Shantel Olivares et al.
PloS one, 9(7), e103828-e103828 (2014-08-01)
Endoplasmic reticulum (ER) stress is induced in many forms of chronic liver disease and may promote the development of hepatocellular carcinoma. The activator protein 1 (AP-1) complex is a transcription factor that promotes hepatic carcinogenesis in response to cellular stress.
Wen-Tsong Hsieh et al.
Journal of neuro-oncology, 118(2), 257-269 (2014-04-24)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor characterized by its rapid infiltration to surrounding tissues during the early stages. The fast spreading of GBM obscures the initiation of the tumor mass making the
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Lina Liang et al.
PloS one, 10(5), e0126384-e0126384 (2015-05-16)
The incidence of obesity is increasing worldwide. It was reported that endoplasmic reticulum stress (ERS) could inhibit insulin receptor signaling by activating c-Jun N-terminal kinase (JNK) in the liver. However, the relationship between ERS and insulin receptor signaling in the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico