Saltar al contenido
Merck

EMU077471

MISSION® esiRNA

targeting mouse Thbd

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting mouse Thbd

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCAGGCTCTTACTCCTGTATGTGTGAGACAGGCTACCAGTTGGCTGCAGACGGACACCGGTGTGAGGACGTGGATGACTGTAAGCAGGGGCCCAATCCATGTCCCCAGCTCTGTGTTAACACCAAGGGCGGCTTCGAATGCTTCTGCTATGATGGCTATGAGTTGGTGGATGGAGAGTGCGTGGAGCTTCTGGATCCGTGTTTCGGATCTAACTGCGAGTTTCAGTGCCAGCCAGTGAGCCCCACCGACTACCGATGCATCTGCGCTCCAGGCTTCGCACCCAAGCCGGATGAACCGCACAAGTGCGAAATGTTCTGCAATGAAACTTCGTGCCCAGCAGACTGTGACCCTAACTCTCCTACTGTTTGTGAATGCCCTGAAGGCTTCATCCTGGACGAGGGTTCCGTATGCACGGACATTGATGAGTGCAGTCAAGGCGAATGCTTCAC

Ensembl | mouse accession no.

ENSMUSG00000074743

NCBI accession no.

NM_009378

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... THBD(21824), Thbd(21824)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
Shahin Assefnia et al.
Oncotarget, 5(6), 1458-1474 (2014-04-01)
Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.
Tadashi Inoue et al.
Human molecular genetics, 23(21), 5672-5682 (2014-06-09)
Latent TGF-β-binding protein-2 (LTBP-2) is an extracellular matrix protein associated with microfibrils. Homozygous mutations in LTBP2 have been found in humans with genetic eye diseases such as congenital glaucoma and microspherophakia, indicating a critical role of the protein in eye
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
Juandong Wang et al.
Medical oncology (Northwood, London, England), 31(8), 112-112 (2014-07-16)
To detect the expression of cancerous inhibitor of phosphatase 2A (CIP2A) in chronic myelocytic leukemia (CML) and investigate the mechanism underlying CIP2A knockdown-mediated cell proliferation and apoptosis as well as the interaction of CIP2A with breakpoint cluster region-Abelson leukemia virus
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico