Saltar al contenido
Merck

EMU082481

MISSION® esiRNA

targeting mouse Stat3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATATGCAGCCAGCAAAGAGTCACATGCCACGTTGGTGTTTCATAATCTCTTGGGTGAAATTGACCAGCAATATAGCCGATTCCTGCAAGAGTCCAATGTCCTCTATCAGCACAACCTTCGAAGAATCAAGCAGTTTCTGCAGAGCAGGTATCTTGAGAAGCCAATGGAAATTGCCCGGATCGTGGCCCGATGCCTGTGGGAAGAGTCTCGCCTCCTCCAGACGGCAGCCACGGCAGCCCAGCAAGGGGGCCAGGCCAACCACCCAACAGCCGCCGTAGTGACAGAGAAGCAGCAGATGTTGGAGCAGCATCTTCAGGATGTCCGGAAGCGAGTGCAGGATCTAGAACAGAAAATGAAGGTGGTGGAGAACCTCCAGGACGACTTTGATTTCAACTACAAAACCCTCAAGAGCCAAGGAGACATGCAGGATCTGAATGGAAACAACCAGTCTGTGACCAGACAGAAGATGCAGCAGCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiuping Zhao et al.
International immunopharmacology, 25(2), 242-248 (2015-02-15)
High-glucose-induced low-grade inflammation has been regarded as a key event in the onset and progression of endothelial dysfunction in diabetic vascular complications. Ginkgolide A (GA), a major compound from Ginkgo biloba extract, is widely used for the treatment of cardiovascular
S Timme et al.
Oncogene, 33(25), 3256-3266 (2013-08-06)
Signal transducer and activator of transcription 3 (STAT3) is altered in several epithelial cancers and represents a potential therapeutic target. Here, STAT3 expression, activity and cellular functions were examined in two main histotypes of esophageal carcinomas. In situ, immunohistochemistry for
Anuradha Bandaru et al.
European journal of immunology, 44(7), 2013-2024 (2014-03-20)
We studied the factors that regulate IL-23 receptor expression and IL-17 production in human tuberculosis infection. Mycobacterium tuberculosis (M. tb)-stimulated CD4(+) T cells from tuberculosis patients secreted less IL-17 than did CD4(+) T cells from healthy tuberculin reactors (PPD(+) ).
Chunli Shao et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4154-4166 (2014-06-08)
Lung cancer stem cells (CSC) with elevated aldehyde dehydrogenase (ALDH) activity are self-renewing, clonogenic, and tumorigenic. The purpose of our study is to elucidate the mechanisms by which lung CSCs are regulated. A genome-wide gene expression analysis was performed to
Ling Qin et al.
American journal of translational research, 7(5), 878-890 (2015-07-16)
MiR-29b has been reported to function as a tumor suppressor in a variety of cancers. However, its role in the regulation of breast cancer is controversial. In this paper, we explored the expression of miR-29b in a cohort of 67

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico