Saltar al contenido
Merck

EMU094061

MISSION® esiRNA

targeting mouse Atg7

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting mouse Atg7

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTTCTGCTCCTGACCTTCGCGGACCTAAAGAAGTACCACTTCTACTACTGGTTTTGCTGCCCCGCCCTCTGTCTTCCTGAGAGCATCCCTCTAATCCGGGGACCTGTGAGCTTGGATCAAAGGCTTTCACCAAAACAGATCCAGGCCCTGGAGCATGCCTATGATGATCTGTGTCGAGCCGAAGGCGTCACGGCCCTGCCCTACTTCTTATTCAAGTACGATGACGACACTGTTCTGGTCTCCTTGCTCAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACAAAGATAACAGTTGGTGTGTACGATCCCTGTAACCTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTGGCAGCCCACAGATGGAGCGGCAGTTTCCAGTCCGTTGAAGTCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bingrong Tang et al.
PloS one, 9(7), e103364-e103364 (2014-07-26)
The two major intracellular protein degradation systems, the ubiquitin-proteasome system (UPS) and autophagy, work collaboratively in many biological processes including development, apoptosis, aging, and countering oxidative injuries. We report here that, in human retinal pigment epithelial cells (RPE), ARPE-19 cells
Hong-Guang Xia et al.
The Journal of cell biology, 210(5), 705-716 (2015-09-02)
Hexokinase II (HK2), a key enzyme involved in glucose metabolism, is regulated by growth factor signaling and is required for initiation and maintenance of tumors. Here we show that metabolic stress triggered by perturbation of receptor tyrosine kinase FLT3 in
Marco B E Schaaf et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 114(3), 406-412 (2015-03-18)
(Pre)clinical studies indicate that autophagy inhibition increases response to anti-cancer therapies. Although promising, due to contradicting reports, it remains unclear if radiation therapy changes autophagy activity and if autophagy inhibition changes the cellular intrinsic radiosensitivity. Discrepancies may result from different
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby
Rong Zheng et al.
Oncotarget, 6(19), 17417-17429 (2015-05-31)
Radiation therapy has an important role in the treatment of breast cancer. Dysfunction p53 and hypoxia are typical biological characteristics of breast cancer that constitute barriers to the efficacy of radiotherapy. Mitophagy plays a protective role in cellular homeostasis under

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico