Saltar al contenido
Merck

EMU196671

MISSION® esiRNA

targeting mouse Hmga2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCATTCGTATAAGAAAAGCATTGTGTGTGACTCTGTGTCCACTCAGATGCCACCCCCACCATGATCATAGAAAATCTGCTTAGGACACCAAAGATGAGAACTAGACACTACTCTCCTTTCTTTGTGTATAATCTTGTAGACACTTACTTGATTTTTTTTTCTTTTTTTACTTTTCAATTCTGAATGAGACAAAATGCTGGTGTATCTTTTCATACAGCTAGCAAACCAGAATAGGTTATGCTCGTTTTTTGCTTTGTTTTGTTTTTCAAAAAGGGAAGTAAACGAGAACCGTTGACTCCTCCATTTATGGACTCATACACAGCAGCAGGAGTGATAAGCCCACAAGCTCTCTTTCCCGCCTCGGGAAATCTACACAGCCAAAAGCCACTTAGCCATAAATGACACTTGTCAGCCTTGAAGCATCGGAGATAACTAGCTGAGTAAAATGATCCTGTTTTGGAATTTAATGAAAAGGTTAACAGTACCCAATGAACCCACCCAAGTGATGAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Chun-Yu Kao et al.
PeerJ, 4, e1683-e1683 (2016-02-20)
High Mobility Group AT-hook 2 (HMGA2) is a nonhistone chromatin-binding protein which acts as a transcriptional regulating factor involved in gene transcription. In particular, overexpression of HMGA2 has been demonstrated to associate with neoplastic transformation and tumor progression in Colorectal
Silvia Parisi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(3), 1046-1058 (2016-12-07)
Lin28 RNA-binding proteins play important roles in pluripotent stem cells, but the regulation of their expression and the mechanisms underlying their functions are still not definitively understood. Here we address the above-mentioned issues in the first steps of mouse embryonic
Zhouying Wu et al.
British journal of haematology, 171(5), 818-829 (2015-09-26)
Acute lymphoblastic leukaemia (ALL) in infants is an intractable cancer in childhood. Although recent intensive chemotherapy progress has considerably improved ALL treatment outcome, disease cure is often accompanied by undesirable long-term side effects, and efficient, less toxic molecular targeting therapies