Saltar al contenido
Merck

EMU206511

MISSION® esiRNA

targeting mouse Kdm6b

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCAGATATGCTGAAGCTCCGGTCACTTAGTGAGGGGCCTCCCAAGGAGCTGAAGATCAGGCTCATCAAGGTGGAAAGTGGGGACAAGGAGACCTTTATCGCCTCTGAGGTGGAAGAGCGGCGGCTGCGCATGGCAGACCTCACCATCAGCCACTGTGCCGCCGATGTCATGCGTGCCAGCAAGAATGCCAAGGTGAAAGGGAAATTCCGAGAGTCCTACCTGTCCCCTGCCCAGTCTGTGAAACCCAAGATCAACACTGAGGAGAAGCTGCCCCGGGAAAAACTCAACCCCCCTACCCCCAGCATCTATTTGGAGAGCAAACGAGATGCCTTCTCGCCGGTCCTGCTACAGTTCTGTACAGACCCCCGGAACCCCATCACCGTCATCAGGGGCCTGGCTGGTTCACTTCGGCTCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Stephanie Dumon et al.
PloS one, 7(8), e43300-e43300 (2012-09-07)
Product of the Itga2b gene, CD41 contributes to hematopoietic stem cell (HSC) and megakaryocyte/platelet functions. CD41 expression marks the onset of definitive hematopoiesis in the embryo where it participates in regulating the numbers of multipotential progenitors. Key to platelet aggregation
Jianchun Wu et al.
Oncology reports, 34(1), 455-460 (2015-05-23)
Mammary stem cells (MSCs) are the progenitor population for human breast epithelia. MSCs give rise during mammary gland development to estrogen receptor (ER)-negative basal cells and the ER- luminal progenitor (LP) population which maintains ER+ and ER- luminal cells. The

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico