Accéder au contenu
Merck

EHU003471

MISSION® esiRNA

targeting human SRF

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human SRF

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGACCTTCAGCAAGAGGAAGACGGGCATCATGAAGAAGGCCTATGAGCTGTCCACGCTGACAGGGACACAGGTGCTGTTGCTGGTGGCCAGTGAGACAGGCCATGTGTATACCTTTGCCACCCGAAAACTGCAGCCCATGATCACCAGTGAGACCGGCAAGGCACTGATTCAGACCTGCCTCAACTCGCCAGACTCTCCACCCCGTTCAGACCCCACAACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGACAGATCTCACCTACCAGGTGTCGGAGTCTGACAGCAGTGGGGAGACCAAGGACACACTGAAGCCGGCGTTCACAGTCACCAACCTGCCGGGTACAACCTCCACCATCCAAACAGCACCTAGCACCTCTACCACCATGCAAGTCAGCAGCGGCCCCTCCTTTCCCATCACCAACTACCTGGCACC

Ensembl | human accession no.

ENSG00000112658

NCBI accession no.

NM_003131

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... SRF(6722), SRF(6722)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
OTU
LSU
KGS
KAS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xi He et al.
Oncology letters, 5(3), 819-824 (2013-02-22)
Recent studies indicate that serum response factor (SRF) is highly expressed in tumors such as hepatocellular, thyroid, esophageal and lung carcinoma. However, the expression and roles of SRF in esophageal squamous cell carcinoma (ESCC) are unclear. In this study, immunohistochemistry
Carolina Leimgruber et al.
Journal of cellular physiology, 232(10), 2806-2817 (2016-11-20)
Prostatic smooth muscle cells (pSMCs) differentiation is a key factor for prostatic homeostasis, with androgens exerting multiple effects on these cells. Here, we demonstrated that the myodifferentiator complex Srf/Myocd is up-regulated by testosterone in a dose-dependent manner in primary cultures
Qi Li et al.
PloS one, 8(9), e75470-e75470 (2013-09-24)
Transcriptional regulation is essential for any gene expression including microRNA expression. MiR-1-1 and miR-133a-2 are essential microRNAs (miRs) involved in cardiac and skeletal muscle development and diseases. Early studies reveal two regulatory enhancers, an upstream and an intragenic, that direct
Min-Seok Kim et al.
Scientific reports, 9(1), 4631-4631 (2019-03-16)
Methylmercury is an environmental pollutant that causes specific and serious damage to the central nervous system. We have previously shown that C-C motif chemokine ligand 4 (CCL4) protects cultured neural cells from methylmercury toxicity and expression of CCL4 is specifically
Long Zhao et al.
International journal of urology : official journal of the Japanese Urological Association, 27(9), 808-816 (2020-06-12)
To explore the regulation and function of serum response factor in epithelial-mesenchymal transition in renal cell carcinoma. First, bioinformatics analysis of human renal cell carcinoma tissues was carried out. Then, the expression of serum response factor, mesenchymal markers (N-cadherin, vimentin
Afficher tous les articles scientifiques apparentés

Contenu apparenté

MISSION esiRNA

Instructions

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique