Accéder au contenu
Merck

EHU018231

MISSION® esiRNA

targeting human SP1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jie Qi et al.
Journal of diabetes research, 2020, 2308520-2308520 (2020-03-19)
Cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) overexpression results in endothelial apoptosis, thus mediating vascular endothelial injury in hyperglycaemia. E26 transformation-specific sequence transcription factor-1 (ESE-1), which belongs to the E26 transformation-specific family of transcription factors, has been demonstrated
Lili Lv et al.
Oncology research, 26(5), 775-783 (2017-12-16)
Cervical cancer is the third most commonly diagnosed malignancy and the fourth leading cause of cancer-related deaths in women worldwide. MicroRNA-296 (miR-296) is aberrantly expressed in a variety of human cancer types. However, the expression levels, biological roles, and underlying
Xiaowei Diao et al.
Oncology reports, 40(2), 1174-1184 (2018-06-20)
Erythropoietin‑producing hepatocellular carcinoma cell surface type‑A receptor 3 (EPHA3) has been found to promote the proliferation and survival of prostate cancer (PCa) cell lines and prostate tumor development in nude mice. However, the regulation of EPHA3 in PCa remains largely unknown.
Im-Kyung Kim et al.
Scientific reports, 9(1), 5933-5933 (2019-04-13)
Specific protein 1 (SP1) is associated with aggressive behavior, invasive clinical phenotype and poor clinical outcomes in various cancers. We studied whether SP1 exerts its effect on invasiveness and promotion of the epithelial-mesenchymal transition (EMT) by regulating lysyl oxidase-like 2
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this

Contenu apparenté

Instructions

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique