Accéder au contenu
Merck

EHU021051

MISSION® esiRNA

targeting human MYC

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYC(4609)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents


Contenu apparenté

Instructions


Juanjuan Liu et al.
Annals of biomedical engineering, 45(6), 1407-1419 (2017-03-30)
Melanoma is a potentially lethal skin cancer with high mortality rate. Recently, the peptide-mediated transdermal delivery of small interference RNA (siRNA) emerges as a promising strategy to treat melanoma by inducing the apoptosis of tumor cells, but the related theoretical
Yili Tao et al.
Scientific reports, 8(1), 14477-14477 (2018-09-29)
Colorectal cancer (CRC) is among the most frequently occurring cancers worldwide. Baicalin is isolated from the roots of Scutellaria baicalensis and is its dominant flavonoid. Anticancer activity of baicalin has been evaluated in different types of cancers, especially in CRC.
Xuyang Wang et al.
World journal of gastroenterology, 23(18), 3252-3261 (2017-06-02)
To determine the role of hepatitis B virus X protein (HBx), HBx in regulating hepatic progenitor cell (HPC)-like features in hepatocellular carcinoma (HCC) and the underlying molecular mechanisms. We used a retrovirus vector to introduce wild type HBx or empty