Accéder au contenu
Merck

EHU023011

MISSION® esiRNA

targeting human ID3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGCTTCCTCATTCTTTGAATCCGCGGCTCCGCGGTCTTCGGCGTCAGACCAGCCGGAGGAAGCCTGTTTGCAATTTAAGCGGGCTGTGAACGCCCAGGGCCGGCGGGGGCAGGGCCGAGGCGGGCCATTTTGAATAAAGAGGCGTGCCTTCCAGGCAGGCTCTATAAGTGACCGCCGCGGCGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACGAGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCCCGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGCGGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGCGCGTCATCGACTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... ID3(3399)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sachindra et al.
Oncotarget, 8(66), 110166-110175 (2018-01-05)
Adaptive resistance to targeted therapy such as BRAF inhibitors represents in melanoma a major drawback to this otherwise powerful treatment. Some of the underlying molecular mechanisms have recently been described: hyperactivation of the BRAF-MAPK pathway, of the AKT pathway, of
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Jayanta K Das et al.
PloS one, 9(8), e104159-e104159 (2014-08-05)
Microvascular lesions resulting from endothelial cell dysfunction are produced in the brain, lung, kidney, and retina of patients of complex chronic diseases. The environmental and molecular risk factors which may contribute in the development of microvascular damage are unclear. The

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique