Accéder au contenu
Merck

EHU030881

MISSION® esiRNA

targeting human EIF2AK3, AC104134.2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGGCACTCCTTTGAACTTTGTCCTTCTGAAGCTTCTCCTTATGTAAGGTCAAGGGAGAGAACCTCCTCTTCAATAGTATTTGAAGATTCTGGCTGTGATAATGCTTCCAGTAAAGAAGAGCCGAAAACTAATCGATTGCATATTGGCAACCATTGTGCTAATAAACTAACTGCTTTCAAGCCCACCAGTAGCAAATCTTCTTCTGAAGCTACATTGTCTATTTCTCCTCCAAGACCAACCACTTTAAGTTTAGATCTCACTAAAAACACCACAGAAAAACTCCAGCCCAGTTCACCAAAGGTGTATCTTTACATTCAAATGCAGCTGTGCAGAAAAGAAAACCTCAAAGACTGGATGAATGGACGATGTACCATAGAGGAGAGAGAGAGGAGCGTGTGTCTGCACATCTTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Palsamy Periyasamy et al.
Autophagy, 12(8), 1310-1329 (2016-06-24)
Cocaine is known to induce inflammation, thereby contributing in part, to the pathogenesis of neurodegeneration. A recent study from our lab has revealed a link between macroautophagy/autophagy and microglial activation. The current study was aimed at investigating whether cocaine could
Qiao Qiao et al.
Cancer science, 108(7), 1421-1431 (2017-04-19)
Endoplasmic reticulum stress (ERS) plays an important role in the pathogenesis and development of malignant tumors, as well as in the regulation of radiochemoresistance and chemoresistance in many malignancies. ERS signaling pathway protein kinase RNA-like endoplasmic reticulum kinase (PERK)-eukaryotic initiation
Saiprasad Ramnarayanan et al.
Biology of reproduction, 95(6), 120-120 (2016-10-14)
There is considerable evidence that implicates oxidative stress in the pathophysiology of human pregnancy complications. However, the role and the mechanism of maintaining an antioxidant prosurvival uterine environment during normal pregnancy is largely unresolved. Herein we report that the highly
Nicholas Catanzaro et al.
Virus research, 276, 197820-197820 (2019-11-20)
Replication of most RNA viruses is closely associated with the endoplasmic reticulum (ER) within permissive cells. As such, viruses often induce tremendous amounts of stress on cells during viral replication. To cope with the stress, cells initiate the unfolded protein
Yanchun Gao et al.
International journal of biological sciences, 16(4), 543-552 (2020-02-07)
Vascular injury is considered an important pathological process during glucocorticoid (GC)-induced osteonecrosis of the femoral head (ONFH). In this study, we tried to investigate whether the endoplasmic reticulum (ER) stress is triggered in the GC-induced endotheliocyte (EC) apoptosis and ONFH.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique