Accéder au contenu
Merck

EHU041711

MISSION® esiRNA

targeting human CPT1A

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACTGAGTCATGCGACTTCGTGCGGGCCATGGTGGACCCGGCCCAGACGGTGGAACAGAGGCTGAAGTTGTTCAAGTTGGCGTCTGAGAAGCATCAGCATATGTATCGCCTCGCCATGACCGGCTCTGGGATCGATCGTCACCTCTTCTGCCTTTACGTGGTGTCTAAATATCTCGCTGTGGAGTCCCCTTTCCTTAAGGAAGTTTTATCTGAGCCTTGGAGATTATCAACAAGCCAGACCCCTCAGCAGCAAGTGGAGCTGTTTGACTTGGAGAATAACCCAGAGTACGTGTCCAGCGGAGGGGGCTTTGGACCGGTTGCTGATGACGGCTATGGTGTGTCGTACATCCTTGTGGGAGAGAACCTCATCAATTTCCACATTTCTTCCAAGTTCTCTTGCCCTGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CPT1A(1374)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Seher Balaban et al.
Molecular cancer research : MCR, 17(4), 949-962 (2019-01-17)
Prostate cancer cells exhibit altered cellular metabolism but, notably, not the hallmarks of Warburg metabolism. Prostate cancer cells exhibit increased de novo synthesis of fatty acids (FA); however, little is known about how extracellular FAs, such as those in the
Jin Seok et al.
Stem cell research & therapy, 11(1), 1-1 (2020-01-05)
Human placenta-derived mesenchymal stem cells (PD-MSCs) are powerful sources for cell therapy in regenerative medicine. However, a limited lifespan by senescence through mechanisms that are well unknown is the greatest obstacle. In the present study, we first demonstrated the characterization
Hideki Iwamoto et al.
Cell metabolism, 28(1), 104-117 (2018-06-05)
Intrinsic and evasive antiangiogenic drug (AAD) resistance is frequently developed in cancer patients, and molecular mechanisms underlying AAD resistance remain largely unknown. Here we describe AAD-triggered, lipid-dependent metabolic reprogramming as an alternative mechanism of AAD resistance. Unexpectedly, tumor angiogenesis in adipose