Accéder au contenu
Merck

EHU043671

MISSION® esiRNA

targeting human SENP3, SENP3-EIF4A1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCCTGAAAAGGTGCATTTCTTCAATAGTTTCTTCTATGATAAACTCCGTACCGGTTATGATGGGGTGAAAAGGTGGACCAAAAACGTGGACATCTTCAATAAGGAGCTACTGCTAATCCCCATCCACCTGGAGGTGCATTGGTCCCTCATCTCTGTTGATGTGAGGCGACGCACCATCACCTATTTTGACTCGCAGCGTACCCTAAACCGCCGCTGCCCTAAGCATATTGCCAAGTATCTACAGGCAGAGGCGGTAAAGAAAGACCGACTGGATTTCCACCAGGGCTGGAAAGGTTACTTCAAAATGAATGTGGCCAGGCAGAATAATGACAGTGACTGTGGTGCTTTTGTGTTGCAGTACTGCAAGCATCTGGCCCTGTCTCAGCCATTCAGCTTCACCCAGCAGGACATGCCCAAACTTCGTCGGCAGATCTACAAGGAGCTGTGTCACTGCAAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SENP3(26168)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jia Luo et al.
The Journal of toxicological sciences, 42(5), 529-538 (2017-07-28)
Increased post-translational modification of proteins by SUMO-2/3 is a cytoprotective response against cell stress induced by ischaemia and reperfusion. However, it is still unclear what other cell stressors trigger protein SUMOylation, what mechanisms enhance and maintain the enhanced SUMOylation, and
Y Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2778-2786 (2018-05-18)
To investigate whether SENP3 protects H9C2 cells from apoptosis triggered by H/R through the signal transducer and activator of transcription 3 (STAT3) pathway. Male C57BL mice were cultured and mouse models of myocardial I/RI were established. At the same time
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Chun-Jie Huang et al.
Biochimica et biophysica acta, 1864(7), 1195-1206 (2017-03-21)
Understanding the mechanisms underlying abnormal egg production and pregnancy loss is significant for human fertility. SENP7, a SUMO poly-chain editing enzyme, has been regarded as a mitotic regulator of heterochromatin integrity and DNA repair. Herein, we report the roles of
Arnab Nayak et al.
Cell reports, 27(9), 2725-2736 (2019-05-30)
Precise assembly of the sarcomere, a force-generating unit in striated muscles, is critical for muscle contraction. Defective sarcomere organization is linked to myopathies and cachexia. The molecular mechanisms concerning sarcomere assembly are poorly understood. Here, we report that the SUMO-specific

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique