Accéder au contenu
Merck

EHU050111

MISSION® esiRNA

targeting human PBK

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGACCCTGAGGCTTGTTACATTGGCACAGAGCCATGGAAACCCAAAGAAGCTGTGGAGGAGAATGGTGTTATTACTGACAAGGCAGACATATTTGCCTTTGGCCTTACTTTGTGGGAAATGATGACTTTATCGATTCCACACATTAATCTTTCAAATGATGATGATGATGAAGATAAAACTTTTGATGAAAGTGATTTTGATGATGAAGCATACTATGCAGCGTTGGGAACTAGGCCACCTATTAATATGGAAGAACTGGATGAATCATACCAGAAAGTAATTGAACTCTTCTCTGTATGCACTAATGAAGACCCTAAAGATCGTCCTTCTGCTGCACACATTGTTGAAGCTCTGGAAACAGATGTCTAGTGATCATCTCAGCTGAAGTGTGGCTTGCGTAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PBK(55872)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

D Herrero-Martín et al.
British journal of cancer, 101(1), 80-90 (2009-06-06)
Ewing sarcoma is a paradigm of solid tumour -bearing chromosomal translocations resulting in fusion proteins that act as deregulated transcription factors. Ewing sarcoma translocations fuse the EWS gene with an ETS transcription factor, mainly FLI1. Most of the EWS-FLI1 target
Jia-Hong Chen et al.
International journal of biological macromolecules, 81, 615-623 (2015-09-01)
Roles and mechanisms of cell cycle-specific transcription factor E2F1 on prostate cancer (PCa) have not been fully elucidated. To address this problem, we here identified PDZ-binding kinase (PBK) as a direct target for E2F1 through bioinformatics binding site prediction, combined
Young-Ju Lee et al.
Biochemical and biophysical research communications, 530(1), 122-129 (2020-08-24)
TGF-β1 is known to induce epithelial-mesenchymal transition (EMT), which is a prerequisite for cancer cell invasion. Here we reveal that TOPK upregulates EMT and invasion of human breast cancer MDA-MB-231 or Hs578T cells via NF-κB-dependent Snail/Slug in TGF-β1 signaling. Endogenous
Young-Ju Lee et al.
Biochemical and biophysical research communications, 522(1), 270-277 (2019-11-24)
TOPK has been suggested to contribute to invasion of lung, prostate, gastric, pancreatic or breast cancer cells. However, how TOPK mediates TGF-β1/Smad signaling leading to epithelial-mesenchymal transition (EMT) and invasion of breast cancer cells remains unknown. Here we report that
Gen Wang et al.
Breast cancer research and treatment, 175(3), 567-578 (2019-04-03)
In early stage, ERα-positive breast cancer, concurrent use of endocrine therapy and chemotherapy has not been shown to be superior to sequential use. We hypothesized that genetic biomarkers can aid in selecting patients who would benefit from chemo-endocrine therapy. Our

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique