Accéder au contenu
Merck

EHU053421

MISSION® esiRNA

targeting human DDIT3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAG

Ensembl | human accession no.

ENSG00000175197

NCBI accession no.

NM_004083

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
ZGU
FGU
QSS
SGT
QAS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lu Fan et al.
Frontiers in pharmacology, 8, 424-424 (2017-07-15)
Hepatocellular carcinoma (HCC) is a malignant primary liver cancer with poor prognosis. In the present study, we report that pekinenin E (PE), a casbane diterpenoid derived from the roots of
Maulasri Bhatta et al.
Cell death & disease, 9(5), 467-467 (2018-04-28)
Persistent vascular injury and degeneration in diabetes are attributed in part to defective reparatory function of angiogenic cells. Our recent work implicates endoplasmic reticulum (ER) stress in high-glucose-induced bone marrow (BM) progenitor dysfunction. Herein, we investigated the in vivo role
Xiaoqing Guo et al.
Anti-cancer drugs, 28(1), 66-74 (2016-09-08)
Tumor necrosis factor related apoptosis-inducing ligand (TRAIL) is a cytokine that selectively induces apoptosis in many tumor cells while leaving normal cells intact and is thus an attractive candidate for antitumor therapies. This paper reports that the combination of tunicamycin
Xiao-Ting Huang et al.
Life sciences, 232, 116612-116612 (2019-07-02)
Accumulating evidence suggest that endoplasmic reticulum (ER) stress is an important mechanism underlying the development of diabetes. We have reported that sustained treatment with N-methyl-d-aspartate (NMDA) results in apoptotic β-cell death and impairs insulin secretion. However, the molecular mechanism responsible
Bin Fang et al.
International journal of biological sciences, 14(10), 1221-1231 (2018-08-21)
Purpose: Small cell lung cancer (SCLC) is highly lethal with no effective therapy. Wee1 kinase inhibitor AZD1775 (MK-1775) and mTOR kinase inhibitor MLN0128 (TAK228) are in clinical trials for relapsed SCLC and recurrent lung cancer, respectively. However, there is no
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique