Accéder au contenu
Merck

EHU058791

MISSION® esiRNA

targeting human PPARD

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGCCTTCTCCAAGCACATCTACAATGCCTACCTGAAAAACTTCAACATGACCAAAAAGAAGGCCCGCAGCATCCTCACCGGCAAAGCCAGCCACACGGCGCCCTTTGTGATCCACGACATCGAGACATTGTGGCAGGCAGAGAAGGGGCTGGTGTGGAAGCAGTTGGTGAATGGCCTGCCTCCCTACAAGGAGATCAGCGTGCACGTCTTCTACCGCTGCCAGTGCACCACAGTGGAGACCGTGCGGGAGCTCACTGAGTTCGCCAAGAGCATCCCCAGCTTCAGCAGCCTCTTCCTCAACGACCAGGTTACCCTTCTCAAGTATGGCGTGCACGAGGCCATCTTCGCCATGCTGGCCTCTATCGTCAACAAGGACGGGCTGCTGGTAGCCAACGGCAGTGGCTTTGTCACCCGTGAGTTCCTGCGCAGCCTCCGCAAACCCTTCAGTGATATCATTGAGCCTAAGTTTGAATTTGCTGTCAAGTTCAACGC

Ensembl | human accession no.

ENSG00000112033

NCBI accession no.

NM_006238

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... PPARD(5467), PPARD(5467)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
WNS
ANS
FQR
UOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mark Wei Yi Tan et al.
Cell death and differentiation, 27(9), 2668-2680 (2020-04-22)
The incidence of nonmelanoma skin cancer (NMSC) has been increasing worldwide. Most studies have highlighted the importance of cancer-associated fibroblasts (CAFs) in NMSC progression. However much less is known about the communication between normal fibroblasts and epithelia; disruption of this
H B Shi et al.
Journal of dairy science, 100(1), 797-806 (2016-11-21)
In rodents, peroxisome proliferator-activated receptor delta (PPARD) is associated primarily with catabolism of fatty acids. However, the role of PPARD in regulating lipid metabolism in ruminant mammary gland remains unknown. In the present study, we assessed the mRNA abundance of
Yi Liu et al.
Cancer research, 79(5), 954-969 (2019-01-27)
APC mutations activate aberrant β-catenin signaling to drive initiation of colorectal cancer; however, colorectal cancer progression requires additional molecular mechanisms. PPAR-delta (PPARD), a downstream target of β-catenin, is upregulated in colorectal cancer. However, promotion of intestinal tumorigenesis following deletion of
Trang Thi Thu Nguyen et al.
The Journal of clinical investigation, 130(7), 3699-3716 (2020-04-22)
The Warburg effect is a tumor-related phenomenon that could potentially be targeted therapeutically. Here, we showed that glioblastoma (GBM) cultures and patients' tumors harbored super-enhancers in several genes related to the Warburg effect. By conducting a transcriptome analysis followed by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique