Accéder au contenu
Merck

EHU062211

MISSION® esiRNA

targeting human PRDX5

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGCTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCCAATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTGGAATGTTGGCCAGATTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PRDX5(25824)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Marshall Ellison et al.
Cell communication and signaling : CCS, 18(1), 15-15 (2020-01-29)
We have previously shown that the zinc finger transcription repressor SNAI2 (SLUG) represses tumor suppressor BRCA2-expression in non-dividing cells by binding to the E2-box upstream of the transcription start site. However, it is unclear how proliferating breast cancer (BC) cells
Gui-Nan Shen et al.
Molecular medicine reports, 17(6), 7827-7834 (2018-04-06)
High concentrations of glutamate may mediate neuronal cell apoptosis by increasing intracellular reactive oxygen species (ROS) levels. Peroxiredoxin V (Prx V), a member of the Prx family, serves crucial roles in protecting cells from oxidative stress. The present study investigated
Geoffroy Walbrecq et al.
Free radical biology & medicine, 84, 215-226 (2015-03-17)
Peroxiredoxin-5 (PRDX5) is a thioredoxin peroxidase that reduces hydrogen peroxide, alkyl hydroperoxides, and peroxynitrite. This enzyme is present in the cytosol, mitochondria, peroxisomes, and nucleus in human cells. Antioxidant cytoprotective functions have been previously documented for cytosolic, mitochondrial, and nuclear

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique