Accéder au contenu
Merck

EHU063441

MISSION® esiRNA

targeting human PACSIN2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGAAGACGCAGAACAACAGAAATAGCCGCCCCTCCCCGCCCACTGTGCCTGTTGGCCTATCATAGATCTCTATGTTCTTGACTTTGTCTCTCCTTTCCGAGTCAATGGTGGGTTACACTGATCTTGTTCCACTGATTACTCTCTCTGACGAGTCCATCACCTGCAACTTAAATGAACAAGCTTACATCCCATTTTGAGTGAAGATTTTGAGGTTTTTAATTTAAAGGCTGTGTACAGTTATACTTTTTTATACACCTGTTCATTTCTACTTAAATTATGGCACAGATTGATGCGCACCAGTCTTGAGGAAACGATCTCCCTATTCCCTTACCCTGTTACTCAGCCACGCCGTGTGTAGGCTTAGCCTCAGGTGGCAGATGTTTGAGGAAAGGAATTATGCCAGGAAGGTGGGACCGGGTTATGGTCGGGTTTCTATTGGGAATGCTCTTTGTGCTTTTGGGCATCTGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaohe Tian et al.
Science advances, 6(48) (2020-11-29)
The blood-brain barrier is made of polarized brain endothelial cells (BECs) phenotypically conditioned by the central nervous system (CNS). Although transport across BECs is of paramount importance for nutrient uptake as well as ridding the brain of waste products, the
Meagan M Postema et al.
Molecular biology of the cell, 30(19), 2515-2526 (2019-08-08)
Apical microvilli are critical for the homeostasis of transporting epithelia, yet mechanisms that control the assembly and morphology of these protrusions remain poorly understood. Previous studies in intestinal epithelial cell lines suggested a role for the F-BAR domain protein PACSIN2

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique