Accéder au contenu
Merck

EHU074571

MISSION® esiRNA

targeting human VHL

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCTGGAAGACCACCCAAATGTGCAGAAAGACCTGGAGCGGCTGACACAGGAGCGCATTGCACATCAACGGATGGGAGATTGAAGATTTCTGTTGAAACTTACACTGTTTCATCTCAGCTTTTGATGGTACTGATGAGTCTTGATCTAGATACAGGACTGGTTCCTTCCTTAGTTTCAAAGTGTCTCATTCTCAGAGTAAAATAGGCACCATTGCTTAAAAGAAAGTTAACTGACTTCACTAGGCATTGTGATGTTTAGGGGCAAACATCACAAAATGTAATTTAATGCCTGCCCATTAGAGAAGTATTTATCAGGAGAAGGTGGTGGCATTTTTGCTTCCTAGTAAGTCAGGACAGCTTGTATGTAAGGAGGTTTGTATAAGTAATTCAGTGGGAATTGCAGCATA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yinghong Zhou et al.
Oxidative medicine and cellular longevity, 2020, 7079308-7079308 (2020-04-11)
Hepatocellular carcinoma (HCC) is regarded as a leading cause of cancer-related deaths, and its progression is associated with hypoxia and the induction of hypoxia-inducible factor (HIF). Meloxicam, a selective cyclooxygenase-2 (COX-2) inhibitor, induces cell death in various malignancies. However, the
Jie Hao et al.
Neurochemical research, 41(9), 2391-2400 (2016-06-22)
The VHL (Von Hippel-Lindau) gene is a tumor suppressor gene, which is best known as an E3 ubiquitin ligase that negatively regulates the hypoxia inducible factor. The inactivation of VHL gene could result in the abnormal synthesis of VHL protein
Susan E Scanlon et al.
Oncotarget, 9(4), 4647-4660 (2018-02-13)
The von Hippel-Lindau (
Dawei Li et al.
Free radical biology & medicine, 110, 102-116 (2017-06-07)
Oxidative stress has a critical role in the pathogenesis of acetaminophen (APAP) induced hepatocellular necrosis, and the identification of novel approaches to attenuate oxidative stress is essential to prevent/revert the disease. This study investigated the role of both HIF-1 and
Mian Wei et al.
Journal of cellular physiology, 234(10), 17392-17404 (2019-02-23)
Microenvironmental hypoxia-mediated drug resistance is responsible for the failure of cancer therapy. To date, the role of the hedgehog pathway in resistance to temozolomide (TMZ) under hypoxia has not been investigated. In this study, we discovered that the increasing hypoxia-inducible

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique