Accéder au contenu
Merck

EHU075891

MISSION® esiRNA

targeting human SOD2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGGCCAAGGGAGATGTTACAGCCCAGATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATTTTCTGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAGGGGAGTTGCTGGAAGCCATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCA

Ensembl | human accession no.

ENSG00000112096

NCBI accession no.

NM_000636

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... SOD2(6648)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
YIU
QCS
HUT
QQT
ZAS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Miyoung Lee et al.
Antioxidants (Basel, Switzerland), 9(1) (2020-01-17)
Umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) are accessible, available in abundance, and have been shown to be a promising source that can regenerate cartilage in patients with osteoarthritis or other orthopedic diseases. Recently, a three-dimensional (3D) cell culture system
Veronica Nobile et al.
Human genetics, 139(2), 227-245 (2020-01-11)
Fragile X-related disorders are due to a dynamic mutation of the CGG repeat at the 5' UTR of the FMR1 gene, coding for the RNA-binding protein FMRP. As the CGG sequence expands from premutation (PM, 56-200 CGGs) to full mutation
Serena Sagliocchi et al.
Redox biology, 24, 101228-101228 (2019-06-04)
Thyroid hormone (TH) is a key metabolic regulator that acts by coordinating short- and long-term energy needs. Accordingly, significant metabolic changes are observed depending on thyroid status. Although it is established that hyperthyroidism augments basal energy consumption, thus resulting in
Chen Zhou et al.
Molecular carcinogenesis, 59(5), 545-556 (2020-03-10)
Colorectal cancer (CRC) is a common malignancy. Many reports have implicated aberrant mitochondrial activity in the progression of CRC, with particular emphasis on the dysregulation of redox signaling and oxidative stress. In this study, we focused on manganese superoxide dismutase
Xiaoqian Wang et al.
Toxicology letters, 327, 9-18 (2020-03-24)
Superoxide dismutase 2 (SOD2) is a key enzyme for scavenging reactive oxygen species produced by mitochondria, which plays an important role in maintaining cellular homeostasis. However, its effects on the detoxification capability of liver cells have not been reported. In
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique