Accéder au contenu
Merck

EHU076621

MISSION® esiRNA

targeting human MAGI2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCTCGGACCTCACAGTCAGTTCCAGATATAACAGATCGGCCGCCTCATTCTCTGCACTCCATGCCAACTGATGGTCAGCTAGACGGCACGTATCCACCGCCCGTCCATGATGACAATGTGTCTATGGCTTCATCTGGGGCCACCCAAGCTGAACTTATGACCTTAACCATTGTGAAAGGTGCCCAGGGCTTCGGCTTCACTATTGCCGACAGTCCTACAGGACAGCGGGTGAAACAAATACTTGACATTCAGGGATGCCCTGGCCTGTGTGAAGGCGACCTCATTGTTGAGATCAACCAGCAGAATGTACAGAACCTGAGCCATACAGAAGTAGTGGATATACTTAAGGACTGTCCCATTGGAAGTGAAACTTCTTTGATTATCCATCGAGGAGGTTTCTTTTCTCCATGGAAAACTCCAAAGCCTATAATGGACCGATGGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAGI2(9863)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Eun-Hee Lee et al.
Scientific reports, 7(1), 5759-5759 (2017-07-20)
Axl receptor tyrosine kinase is involved in the tumorigenesis and metastasis of many cancers. Axl expression was markedly higher in human papilloma virus type 16E6 (HPV16E6)-overexpressing HeLa (HE6F) cells and lower in HPV16E6-suppressing CaSki (CE6R) cells than in the controls.
Blanca L Valle et al.
Cancer prevention research (Philadelphia, Pa.), 13(9), 783-794 (2020-06-26)
Molecular alterations that contribute to long-term (LT) and short-term (ST) survival in ovarian high-grade serous carcinoma (HGSC) may be used as precision medicine biomarkers. DNA promoter methylation is an early event in tumorigenesis, which can be detected in blood and
Saurabh Pandey et al.
The Journal of biological chemistry, 295(25), 8575-8588 (2020-05-08)
Group I metabotropic glutamate receptors (mGluRs) play important roles in various neuronal functions and have also been implicated in multiple neuropsychiatric disorders like fragile X syndrome, autism, and others. mGluR trafficking not only plays important roles in controlling the spatiotemporal