Accéder au contenu
Merck

EHU077571

MISSION® esiRNA

targeting human BSG

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGAGGCAGGTGGCCCGAGGACGCTCCCTGCTCCACGTCTGCGCCGCCGCCGGAGTCCACTCCCAGTGCTTGCAAGATTCCAAGTTCTCACCTCTTAAAGAAAACCCACCCCGTAGATTCCCATCATACACTTCCTTCTTTTTTAAAAAAGTTGGGTTTTCTCCATTCAGGATTCTGTTCCTTAGGTTTTTTTCCTTCTGAAGTGTTTCACGAGAGCCCGGGAGCTGCTGCCCTGCGGCCCCGTCTGTGGCTTTCAGCCTCT

Ensembl | human accession no.

ENSG00000172270

NCBI accession no.

NM_198591

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
WNS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tomoki Yoshioka et al.
The American journal of pathology, 189(7), 1338-1350 (2019-04-25)
Podocytes, which are susceptible to injury by various stimuli and stress, are critical regulators of proteinuric kidney diseases, regardless of the primary disease and pathogenesis. We further confirmed a significant correlation between urinary CD147/basigin (Bsg) levels and proteinuria in patients
Yao Meng et al.
Frontiers in cell and developmental biology, 8, 543856-543856 (2020-11-17)
Cancer stem cells (CSCs), responsible for cancer metastasis and recurrence, are generated from non-CSCs after chemo-radiation therapy. This study investigated the induction of CSC potential in non-stem breast cancer cells and the underlying molecular mechanisms in detachment culture. Bulk breast
Chaoqun Wang et al.
The American journal of pathology, 188(7), 1597-1607 (2018-04-10)
Epithelial-to-mesenchymal transition (EMT) is postulated to be a prerequisite for the establishment of endometriosis (EMS), a common reproductive disorder in women. Our previous studies have demonstrated the elevated expression of transmembrane glycoprotein CD147 and its prosurvival effect on abnormal cells
Baohua Su et al.
Iranian journal of basic medical sciences, 21(8), 806-812 (2018-09-07)
The study aimed to uncover the underlying mechanism linking wear particles to osteoclast differentiation, and we explored the effect of titanium particles of different sizes on CD147 expression and autophagy in macrophages. Effects of titanium particles on CD147 and RANKL
Junchen Chen et al.
PloS one, 12(8), e0183689-e0183689 (2017-08-24)
Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique