Accéder au contenu
Merck

EHU077611

MISSION® esiRNA

targeting human VAV3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGTGGAGTCAGCCATCTCTAGTTTAGACTACATTTCTAAGACAAAAGAAGATGTCAAACTGAAATTAGAGGAATGTTCCAAAAGAGCAAATAATGGGAAATTTACTCTTCGAGACTTGCTTGTGGTTCCTATGCAACGTGTTTTAAAGTACCACCTTCTCCTCCAGGAACTGGTCAAACATACCACTGATCCGACTGAGAAGGCAAATCTGAAACTGGCTCTTGATGCCATGAAGGACTTGGCACAATATGTGAATGAAGTGAAAAGAGATAATGAGACCCTTCGTGAAATTAAACAGTTTCAGCTATCTATAGAGAATTTGAACCAACCAGTTTTGCTTTTTGGACGACCTCAGGGAGATGGTGAAATTCGAATAACCACTCTAGACAAGCATACCAAACAAGAAAGGCATATCTTCTTATTTGATTTGGCAGTGATCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jie Sha et al.
Endocrinology and metabolism (Seoul, Korea), 29(3), 363-370 (2014-10-14)
The role of small GTPase molecules is poorly understood under high glucose conditions. We analyzed the expression pattern of Vav3 in skeletal muscle C2C12 cells under high glucose culture condition with reverse transcription-polymerase chain reaction and Western blot analysis. We
Takeo Nomura et al.
Molecular cancer, 12, 27-27 (2013-04-10)
The Vav family of Rho/Rac guanosine nucleotide exchange factors comprises three members in mammalian cells. Vav3 enhances androgen receptor (AR) activity during progression to androgen independence in prostate cancer. We examined Vav3 small interfering RNA (siRNA) effects on cell proliferation
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique