Accéder au contenu
Merck

EHU080501

MISSION® esiRNA

targeting human ARHGAP4

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGGAGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCCCTGGTGGTGGAGAGCTGCATTCGCTTCATCAACCTCAATGGCC

Ensembl | human accession no.

ENSG00000089820

NCBI accession no.

NM_001666

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ARHGAP4(393)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dabin Lee et al.
Cell death & disease, 9(5), 495-495 (2018-05-03)
Chemokine CCL4 (MIP-1β) is released from osteoblast cells to restore the homeostasis of hematopoietic stem cells during the activation of bone marrow. In this study, we investigated the function of CCL4 and its receptor CCR5 during osteoclastogenesis. CCL4 promoted the
P-S Hu et al.
Oncogene, 36(33), 4706-4718 (2017-04-11)
Polycomb group (PcG) proteins play an important role in development and stem cell maintenance, and their dysregulation have been closely linked to oncogenesis and cancer stem cell phenotypes. Here, we found that nervous system polycomb 1 (NSPc1) was highly expressed
Y-B Yu et al.
Acta physiologica (Oxford, England), 219(2), 465-477 (2016-05-28)
Erythropoietin (EPO), the key hormone involved in erythropoiesis, beneficially affects endothelial cells (ECs), but the detailed mechanisms are yet to be completely understood. In this study, we investigated the role of transient receptor potential vanilloid type 1 (TRPV1), a ligand-gated
Yehua Shen et al.
OncoTargets and therapy, 12, 5003-5012 (2019-07-16)
The phenomenon that cancer cells avidly exhibit glycolysis with lactate secretion and decrease in mitochondrial activity under aerobic conditions is known historically as the Warburg effect. Rho GTPase-activating protein 4 (ARHGAP4) is an important negative regulator of the Rho signaling
Suresh Govatati et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(5), 1256-1274 (2020-03-13)
In view of our previous observations on differential expression of LMCD1 (LIM and cysteine-rich domains 1) in human versus rodents, we asked the question whether LMCD1 plays a species-specific role in the development of vascular lesions. Approach and Results: A
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique