Accéder au contenu
Merck

EHU085781

MISSION® esiRNA

targeting human ATG5

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTATTTGCCTGAACAGAATCATCCTTAAATGGGATTTATCAGAGCATGTCACCCTTTTGCTTCAATCAGGTTTGGTGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCAGACAGGAAAAAGATTCCATGTCAGATAAGGCAACTGGGCTGGTCTTACTTTGCATCACCTCTGCTTTCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

ATG5 (autophagy protein 5) is involved in the formation of autophagosomes. It is part of the E3-like ATG12-ATG5-ATG16 complex, which is involved with autophagic vesicle formation and expansion. ATG5 is also needed for antigen presentation and thereby enhances viral clearance. Mutation in this gene decreases autophagy, thereby causing ataxia with developmental delay. The ATG5 gene is upregulated in systemic lupus erythematosus. It is also associated with Behçet′s disease. Polymorphisms in this gene are linked with neutrophilic airway inflammation, particularly in adult asthma.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Association of autophagy related gene polymorphisms with neutrophilic airway inflammation in adult asthma.
Pham DL
The Korean Journal of Internal Medicine, 31, 375-375 (2016)
Detecting Genetic Associations between ATG5 and Lupus Nephritis by trans-eQTL.
Zhang YM
Journal of immunology research, 2015, 153132-153132 (2015)
Mutation in ATG5 reduces autophagy and leads to ataxia with developmental delay.
Kim M
eLife, 5, e12245-e12245 (2016)
Yiming Shao et al.
Scientific reports, 7(1), 9399-9399 (2017-08-26)
Previous studies demonstrated significant roles of autophagy in the pathogenesis of sepsis, but few studies focused on the effect of autophagy-related SNPs on sepsis susceptibility. In this present study, five polymorphisms of ATG5/ATG16L1 were investigated for the possible risk on
Association of ATG5 Gene Polymorphisms With Behcet's Disease and ATG10 Gene Polymorphisms With VKH Syndrome in a Chinese Han Population.
Zheng M
Investigative Ophthalmology & Visual Science, 56, 8280-8280 (2015)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique