Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCTGCTGGACTTCCTCATCAAGTCCTCATTCATTGGAGTATCTGGAGAGGAGGTGTGGTTTGATGAGAAAGGAGACGCTCCTGGAAGGTATGATATCATGAATCTGCAGTACACTGAAGCTAATCGCTATGACTATGTGCACGTTGGAACCTGGCATGAAGGAGTGCTGAACATTGATGATTACAAAATCCAGATGAACAAGAGTGGAGTGGTGCGGTCTGTGTGCAGTGAGCCTTGCTTAAAGGGCCAGATTAAGGTTATACGGAAAGGAGAAGTGAGCTGCTGCTGGATTTGCACGGCCTGCAAAGAGAATGAATATGTGCAAGATGAGTTCACCTGCAAAGCTTGTGACTTGGGATGGTGGCCCAATGCAGATCTAACAGGCTGTGAGCCCATTCCTGTGCGCTATCTTGAGTGGAGCAACATCGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GRM1(2911)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Rachel E Sexton et al.
Scientific reports, 8(1), 16008-16008 (2018-10-31)
Breast cancer remains a major cause of death among women. 15% of these cancers are triple negative breast cancer (TNBC), an aggressive subtype of breast cancer for which no current effective targeted therapy exists. We have previously demonstrated a role
Mohanan Valiya Veettil et al.
PLoS pathogens, 10(10), e1004389-e1004389 (2014-10-10)
Kaposi's sarcoma associated herpesvirus (KSHV) is etiologically associated with endothelial Kaposi's sarcoma (KS) and B-cell proliferative primary effusion lymphoma (PEL), common malignancies seen in immunocompromised HIV-1 infected patients. The progression of these cancers occurs by the proliferation of cells latently