Accéder au contenu
Merck

EHU088381

MISSION® esiRNA

targeting human EGLN1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human EGLN1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGGCGCTCGAGTACATCGTGCCGTGCATGAACAAGCACGGCATCTGTGTGGTGGACGACTTCCTCGGCAAGGAGACCGGACAGCAGATCGGCGACGAGGTGCGCGCCCTGCACGACACCGGGAAGTTCACGGACGGGCAGCTGGTCAGCCAGAAGAGTGACTCGTCCAAGGACATCCGAGGCGATAAGATCACCTGGATCGAGGGCAAGGAGCCCGGCTGCGAAACCATTGGGCTGCTCATGAGCAGCATGGACGACCTGATACGCCACTGTAACGGGAAGCTGGGCAGCTACAAAATCAATGGCCGGACGAAAGCCATGGTTGCTTGTTATCCGGGCAATGGAACGGGTTATGTACGTCATGTTGATAATCCAAATGGAGATGGAAGATGTGTGAC

Ensembl | human accession no.

ENSG00000135766

NCBI accession no.

NM_022051

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... EGLN1(54583), EGLN1(54583)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
GZT
QCS
MBS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Junqiang Guo et al.
Artificial cells, nanomedicine, and biotechnology, 48(1), 37-45 (2019-12-20)
Background: Prolyl hydroxylase domain proteins (PHD2) is an oxygen sensor that is able to induce hypoxia-inducible factor-α (HIF-α) degradation under normoxic condition. The present paper designed to reveal the function of PHD2 in hepatocellular carcinoma (HCC) cells proliferation, migration and
Junping Hu et al.
Scientific reports, 7(1), 15878-15878 (2017-11-22)
Proteinuria is closely associated with the progression of chronic kidney diseases (CKD) by producing renal tubulointerstitial fibrosis. Over-activation of hypoxia inducible factor (HIF)-1α has been implicated in the progression of CKD. The present study tested the hypothesis that HIF-1α mediates
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian
Anindya Dey et al.
Science advances, 6(27) (2020-09-17)
The stringent expression of the hypoxia inducible factor-1α (HIF-1α) is critical to a variety of pathophysiological conditions. We reveal that, in normoxia, enzymatic action of cystathionine β-synthase (CBS) produces H2S, which persulfidates prolyl hydroxylase 2 (PHD2) at residues Cys21 and
Kai Zhu et al.
International journal of nanomedicine, 9, 5203-5215 (2014-11-28)
Mesenchymal stem cell (MSC) transplantation has attracted much attention in myocardial infarction therapy. One of the limitations is the poor survival of grafted cells in the ischemic microenvironment. Small interfering RNA-mediated prolyl hydroxylase domain protein 2 (PHD2) silencing in MSCs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique