Accéder au contenu
Merck

EHU089961

MISSION® esiRNA

targeting human LYN

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAGGGAATGGCATACATCGAGCGGAAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATGTGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGGGAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTCACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGGAAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTACAGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGGAAAGAAAAGGCAG

Ensembl | human accession no.

ENSG00000147507

NCBI accession no.

NM_002350

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
GWU
JUU
WSU
YVR
RPR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shuaibin Liu et al.
Oncotarget, 7(46), 75468-75481 (2016-10-01)
Cervical cancer is one of the most common malignant tumor in women. The mechanisms of cervical cancer are intricate and have not been fully understood. Therefore, we employed iTRAQ to obtain novel proteins profile which participates in the tumor oncogenesis
Xiaoyun Wang et al.
Scientific reports, 7, 42675-42675 (2017-02-17)
Hypersecretion of mucus is an important component of airway remodeling and contributes to the mucus plugs and airflow obstruction associated with severe asthma phenotypes. Lyn has been shown to down-regulate allergen-induced airway inflammation. However, the role of Lyn in mucin
Lei Meng et al.
Acta biochimica et biophysica Sinica, 52(1), 49-57 (2019-12-13)
Gastric cancer (GC) is one of malignant tumors with high mortality and morbidity in the world. MicroRNA-122 (miR-122) acts as a tumor suppressor in a variety of cancers and has been found to be dominant in gastric adenocarcinoma. However, the
D Thaper et al.
Oncogene, 36(28), 3964-3975 (2017-03-14)
The acquisition of an invasive phenotype by epithelial cells occurs through a loss of cellular adhesion and polarity, heralding a multistep process that leads to metastatic dissemination. Since its characterization in 1995, epithelial-mesenchymal transition (EMT) has been closely linked to
Pradip Das et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 181-192 (2020-12-06)
MCP-1-induced monocyte chemotaxis is a crucial event in inflammation and atherogenesis. Identifying the important signal transduction pathways that control monocyte chemotaxis can unravel potential targets for preventive therapies in inflammatory disease conditions. Previous studies have shown that the focal adhesion
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique