Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGCTGAAGTTGAACATGGGAGCTTATTGCTAATTTAGAGATAGGAAACTGAAGCATAAAGAATTAATGACTTACTTTAATTACTGGAATTCTTCTGCAACATTTGACAAAACTAACCTTGAATAAGGCCCACTGTAATACGTAGCTCTCTTAAATATAACACTTAGGACTAGAAGATTAGAAACTACCAATCCCAACTACGTAATAGGAAAATGTAGGATCAAAAGGCCCATGTATATAAGTACTGACCACTGGGCCATAATGTTGCTTCTCAGGCTATATGCAGTCCTTTAGTCAGAAGTCAATAGGCCTATTTATTAATATTTTACAGACCATATTACCTGGATTACCAGGGACTATCTTTGCTGC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CTNND1(1500)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Xiao-Hui Gao et al.
Scientific reports, 10(1), 44-44 (2020-01-09)
Low miR-96-5p expression is characteristic of many cancers but its role in breast cancer (BCa) remains poorly defined. Here, the role of miR-96-5p in BC development was assessed. We demonstrate that exogenously expressing miR-96-5p inhibits the proliferative, migratory and invasive
Ningjia Cao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 483-490 (2018-07-11)
MicroRNAs (miRNAs) are solid factors involved in the initiation and progression of hepatocellular carcinoma (HCC). Recently, miR-298 is recognized as a cancer-associated miRNA in breast, gastric and ovarian cancer. However, the functional role of miR-298 and its underlying mechanism are
Alisha M Mendonsa et al.
PloS one, 15(6), e0235337-e0235337 (2020-06-27)
p120-catenin is considered to be a tumor suppressor because it stabilizes E-cadherin levels at the cell surface. p120-catenin phosphorylation is increased in several types of cancer, but the role of phosphorylation in cancer is unknown. The phosphorylation state of p120-catenin